lunes, 14 de mayo de 2012

Tarta de Mousse de Lilas o Violetas:

Hola a tod@s: hoy es el cumpleaños de mi marido y como es normal ,le hemos preparado una fiesta, mis hijos y yo, el resto de la family está fuera. Hace tiempo que vi esta tarta en el blog de Ana y desde el primer momento supe que esta sería la tarta que haría para el cumple de mi niño grande!!
Aclararos que mis caramelos preferidos son los de lilas ( ME ENCANTAN) y no sólo eso, sino que además me traen muy buenos recuerdos de mi niñez... total que fue ver la tarta y me enamoré de ella!! ya estaba salivando sólo de verla en la pantalla del ordenador, a Ana le quedo de infarto!! ( al final os pongo una entrada directa a su blogg, ir a visitarla que no os defraudará).
Yo he tenido que tunear la receta por fuerza mayor, olvidé comprar la nata para montar y cuando me he puesto manos a la obra, ya era tarde... a si que... ingenio para qué te quiero?? abro nevera y veo terrina de mascapone... pienso!!... mascarpone = a mucha grasa, nata = a mucha grasa... EURECA!! y así lo he hecho y este ha sido el resultado...




PARA LA BASE:


Ingredientes: ( yo he puesto el doble de todas las medidas de Ana porque quería que me saliese más de una tarta para mis amigas y mis compis del trabajo).


- Una bolsa de 400 gr. de galletas digestivas con soja y fruta (son de una marca del lidell, y están muy buenas).
- 250 gr. de mantequilla
- Una cucharada de leche
Preparación:
Triturar las galletas en la picadora hasta pulverizarlas.
Fundir la mantequilla en el microondas y añadir un chorrito de leche.
Mezclar las galletas trituradas con la mantequilla fundida y la leche.
Disponer un molde desmontable  sobre la bandeja dónde vamos a servir, poner las galletas trituradas y con el dorso de una cuchara grande, distribuir y apretar bien hasta que quede la base bien plana y compacta, meter en el frigorífico mientras que preparamos la mousse.

PARA LA MOUSSE

Ingredientes:
- 200 gr. de caramelos de violeta.
- 2 terrina de queso de untar cremoso (philadelphia)
- 1 terrina de mascarpone.
- 9 hojas de gelatina.
-   1 vasito y 1/2 de leche.

Preparación:
Poner a remojo la gelatina en agua .
Triturar los caramelos con la picadora hasta que estén totalmente pulverizados y reservar en un bol.
Poner en un cacito la leche, calentar y disolver en ella la gelatina, apartar del fuego y añadir el queso crema mezclando bien, el mascarpone  y mezclar con varillas suavemente hasta tener una mezcla homogénea.
Echar la mezcla sobre la base de galleta que tenemos en el frigorífico y volver al frigorífico hasta que cuaje (unas dos horas).
PARA LA COBERTURA

Ingredientes:
- 300 gr. de agua ( la he pesado en las báscula).
- 200 gr. de caramelos de violeta
- 4 hojas de gelatina.
- La punta de una cucharilla de colorante en gel, de color lila, para acentuar aún más el tono.
Preparación:
Poner las hojas de gelatina en remojo en un cuenco con agua
Poner el agua en un cacito al fuego y echar los caramelos, cocer hasta que se disuelvan por completo, añadir la gelatina remojada y remover hasta que se disuelva junto con el colorante en gel y remover bien para que el color quede omogéneo.
Dejar enfriar un poco antes de volcarlo sobre la mousse (ésta mezcla guarda muchísimo el calor y si la ponemos caliente sobre la mousse, se derrite la superficie de ésta y se nos estropea la cobertura) a mí me pasó igual que a Ana y eso que leí su nota, esperé a que se quedase templada, pero aún así no lo suficiente, pero como tenía más caramelos hice más gelatina, esperé y arreglé el "estropicio" en la tarta no se nota mucho...por suerte!!!
Como he dicho he hecho masa de más y he preparado unas tartaletas en moldes de magdalenas (10 unidades) para bajar a las amigas y niñ@s al parque, que han quedado muy monas y les han gustado mucho, sólo pongo las fotos del principio, porque luego con las prisas no he hecho más... ( os comento: para que los moldes no se abriesen los he puesto en unos que tengo de silicona y éstos los he llenado hasta la mitad de arroz,  luego he colocado los de las magdalenas encima, con la base de galleta, la mousse y por último sin gelatina, sólo he puesto un caramelo de lilas a cada una y han quedado muy finas, lástima lo de no hacer las fotos, soy muy despistada y hoy he tenido un día de corre, corre total!!) y también una mini tarta para una compi del trabajo Cristina, la que me trae los caramelos de Madrid, cada vez que va, porque en Barcelona no los encuentro...(esa tartita aún la tengo en la nevera sin desmoldar para llevársela mañana)... como veis me ha cundido mucho!!
Y ya sin más enrollarme esta es la tarta paso a paso... tachan tachannnnnn!!!



















Aquí os dejo la entrada al blogg de Ana.
Read more:
Cocina con Ana: MOUSSE DE VIOLETA http://www.cocinaconana.com/2009/06/mousse-de-violeta.html#ixzz1usJedhNM
Under Creative Commons License: Attribution

38 comentarios:

  1. que estupenda tarta, felicidades a tu marido, mira los caramelos de violetas lo encuentro en carefour, besos

    ResponderEliminar
    Respuestas
    1. Muchas gracias guapa!! no me digas?? dónde, en el de glorias, o la maquinista?, nunca los he visto... qué están en la sección de chuches??,
      M gustaría encontarlos porque así no tengo que molestar a Cris, cada vez que va a Madrid para que me los traiga.
      Un besete Guapa!!

      Eliminar
  2. Genial y grandiosa tarta, me gusta el color d ela capa externa..... ay que rica.....

    ResponderEliminar
    Respuestas
    1. Gracias Guapi!! la verdad que ha quedado muy rica, no muy dlce ( con lo cual no empacha) y muy esponjosa, vamos que le doy dos días en la nevera,como muchoooo!!
      Un besete!!

      Eliminar
  3. que buena tiene que estar¡¡¡¡TE INVITO A QUE TE PASES POR MI BLOG YA QUE ESTOY DE CONCURSO POR SI TE ANIMAS A PARTICIPAR ,BESOTES http://elblogdedeboramisrecetasdeldiaadia.blogspot.com.es/2012/05/2-concurso-del-blog-de-debora.html

    ResponderEliminar
    Respuestas
    1. Hoy me paso!! muchas gracias guapa!!
      Un besete!!

      Eliminar
  4. Te ha quedado fantástica y los cambios le han ido de maravilla...felicidades para tí y para el homenajeado...

    Un saludo!!

    ResponderEliminar
    Respuestas
    1. Gracias Ana, viniendo de ti me encnatan estos cumplidos, porque la tuya, como ya he dicho, era de INFARTO!!
      Un besete Guapa!!

      Eliminar
  5. Felicita a tu marido de mi parte, y dile de paso a el que te felicite por este pedazo de tarta que te has marcado para su cumple!!!
    Un besete!!

    ResponderEliminar
    Respuestas
    1. Muchas gracias Guapa, a él le ha encantado y a mi hija ( que no le gustan nunca las tartas) también así que esta vez hemos acertados!!
      Un besete!!

      Eliminar
  6. Te ha quedado de 10, esta preciosa y rica. Un besin.

    ResponderEliminar
    Respuestas
    1. Gracias Guapa!!
      Ayer pasé por tu blogg y me quedé por allí, me ha gustado mucho!!
      Un besete para ti también!!

      Eliminar
  7. Felicidades al cumpleañero, y la tarta te ha quedado preciosa, besitos

    ResponderEliminar
    Respuestas
    1. Muchas gracias Vivi, ya felicito a mi marido de tu parte!!
      Un besete!!

      Eliminar
  8. Felicidades a tu marido, le habrá encantado la tarta, porque está muy buena, te ha quedado muy bien, brillante y te ha cundido mucho.
    Yo la hice en copas, sin base y queda también un buen postre.
    La idea del mascarpone, genial.
    Besos.

    ResponderEliminar
    Respuestas
    1. Gracias guapa, ya me acuerdo de la tuya, me encanto el postre, es que a mi todo lo que sea de lilas o viletas, me vuelve loca. Tu postre lo tengo apuntado para otra ocasión, estoy esperando que me llamen de Gadget para ir a recoger la esencia de violetas... ya te contaré.
      lo del mascarpone, fue por necesidad, pero ha quedado bien!1
      Un besete y buena semana!!

      Eliminar
  9. Tu tarta muy original me gusta!!!! un beso

    ResponderEliminar
    Respuestas
    1. Gracias Guapa!!pero ya sabes que la idea no es mia!!
      Un besete!!

      Eliminar
  10. Me encanta la tarta!! te sobro algun trocillo para mi?? tiene muy buena pinta, que pena no poder probarla, un beso :)

    ResponderEliminar
    Respuestas
    1. Hay un trocito en la nevera aún, lo malo que será un poco complicado mandártela!! pero si queires venir por ella aquí está!!
      Un besete!!

      Eliminar
  11. Jolinnnnnnnnn vaya tarta, te ha quedado preciosa, perfecta.
    Felicidades al cumpleañero, así se pueden soplar velas.
    Un beso

    ResponderEliminar
    Respuestas
    1. Muchas gracias!!! ya le doy las felicitaciones de tu parte!!
      Un besete!!

      Eliminar
  12. Yo también quiero una tarta de esas para mi cumpleaños..Te ha quedado preciosa,espero que pasaseis un día estupendo.

    Un besito!

    ResponderEliminar
    Respuestas
    1. Pués pide y se concederá!! la receta es muy fácil y el gustillo que te queda cuando la estas comiendo es ummm!! muy rico!!
      Gracias Guapa e igualmente!!
      Un besete!!

      Eliminar
  13. te ha quedado genial¡¡¡ muy buena pinta

    ResponderEliminar
    Respuestas
    1. Gracias Guapa!! la verdad que les ha encantado también a mis compis de trabajo!!
      Un besete!!

      Eliminar
  14. Te quedó fabulosa y que buena idea la de apañar la falta de nata con el mascarpone. Seguro que la tarta fue un exitazo total y al cumpleañero lo encantó. Besitos.
    cosicasdulces.blogspot.com

    ResponderEliminar
    Respuestas
    1. Pués sí, la mouse quedó muy bien, un poquito más consistente que con la nata, pero muy rica, la gelatina me quedó bien para el mismo día, pero hoy estaba un poco dura, la próxima vez pondré una lámina menos...
      Un besete!!

      Eliminar
  15. te ha quedado de fábula !! tiene una pinta espectacular la tarta, seguro que mejor sabia ja ja ja.
    muchas felicidades le das a Jose que andamos como locos, mejor te llamo una noche.
    besitos !!

    ResponderEliminar
    Respuestas
    1. te entiendo muuu bien, yo ni acordarme del de Nino, que fue a finales del més pasado, verdad? 29?? ya hablaremos un día de estos!! Cómo te encuentras ya??
      Un besete!!

      Eliminar
  16. Bueno!!!!!! que maravilla de tarta y que contento el homenajeado, no?

    Petons

    ResponderEliminar
    Respuestas
    1. Si que le ha gustado mucho, no para de ir a la nevera a por un trocito, hoy ya casi no queda... menos mal que esta mañana he pillado un trozo para mis compis, que sino, no la prueban!!
      Un peton maca!!

      Eliminar
  17. Jo0o que pinta niña!
    Y con ese aroma de caramelo de violetas que es taaaaaaaaaaaaaan rico0o y delicado... Me encanta beso0os

    ResponderEliminar
  18. Hola Nechy, primero muchas felicidades a tu marido.
    La tarta fantastica y muy buena idea lo del queso, a falta de pan buenas don tortas,
    Me quedo por aqui mirando tu cocina, que se ven cositas deliciosas.
    Besotes

    ResponderEliminar
    Respuestas
    1. Hola Mº Luz. se bienvenida, me alegro de encontar caras nuevas, siempre digo, cuantos más somos mejores ideas tendremos!!
      Un besete!!

      Eliminar
  19. GUAAAAAAAAAAUUUUUUUUU!!! que tarta más original, me encanta!. Sin duda te deja con la boca abierta. Gracias por compartirla.
    Saludos, Sandra.
    www.miscositassrv.blogspot.com

    ResponderEliminar
    Respuestas
    1. Muchas gracias a ti Guapa!! pero ya sabes que la idea no es mia, yo sólo la he hecho tueándola un poco y por fuerza mayor!! pero eso sí estaba para chuparse los dedos!!

      Eliminar

Hola Guap@s!! no imaginais la ilusión que me hace que me dediqueis un ratito y luego leer vuestros comentarios... Muchas gracias por estar ahí!!